Skip to content

Mutant wirusa zapalenia wątroby typu B związany z epidemią zapalnego zapalenia wątroby ad

5 dni ago

497 words

Następnie surowicę dekantowano po krótkim czasie wirowania (30 sekund przy 10 000 x g). Perełki przemyto trzy razy solanką buforowaną fosforanem i jednokrotnie wodą w celu usunięcia składników surowicy. Po ostatnim płukaniu do kulek dodano 25 .l wody. DNA HBV uwolniono z wychwyconych wirionów przez ogrzewanie w 95 ° C przez 10 minut. Następnie 12,5 .l supernatantu stosowano do PCR w całkowitej objętości reakcji 25 .l zawierającej 10 pmoli każdego startera oligonukleotydowego w buforze reakcyjnym (10 mM TRIS kwas solny, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu 0,01% [wag./obj.] Żelatyny, 200 .M dATP, dGTP, dCTP i TTP oraz 0,625 jednostki polimerazy Taq [Perkin-Elmer Cetus]). Mieszaniny reakcyjne pokryto 50 .l oleju mineralnego, aby zapobiec parowaniu. Próbki poddano 35 cyklom składającym się z denaturacji w 94 ° C przez jedną minutę, hybrydyzacji w temperaturze 55 ° C przez jedną minutę i wydłużania w 72 ° C przez dwie minuty. Jako startery zastosowano 5 GAAAGCTTCTGCGACGCGGCGATTGAGA3 (nukleotydy 2429 do 2410 w podtypie HBV adw, GenBank [komputerowy depozyt sekwencji kwasów nukleinowych]) i 5 TGGAATTCGCATGGAGACCACCGTGAAC3 (nukleotydy 1608 do 1627 w podtypie HBV adw, GenBank). Podkreślona sekwencja w pierwszym primerze reprezentuje miejsce restrykcyjne Hindlll, a w drugim primerze miejsce EcoRI. Ponadto, próbkę surowicy trawiono w 10 mM EDTA (pH 8,0), 1% dodecylosiarczanu sodu, mg proteinazy K. na mililitr i 5 .g przenoszącego RNA w temperaturze 50 ° C przez trzy godziny, a następnie ekstrahowano jeden raz. z fenolem i jednokrotnie z chloroformem i wytrąconym etanolem. Wyekstrahowany DNA poddano amplifikacji PCR, jak opisano powyżej. Wszystkie odpowiednie środki ostrożności zostały zaobserwowane, aby zminimalizować zanieczyszczenie PCR.9 Klonowanie i sekwencjonowanie
Fragmenty 822 bp (pary zasad) DNA HBV wytworzone przez dwa startery obejmujące region X, przedwzmacniacz i regiony rdzeniowe wszystkich sześciu pacjentów, podejrzany pacjent źródłowy i kontrole zostały sklonowane do pGEM7Zf (+) (Promega Biotech, Madison, Wis.) I sekwencjonowano za pomocą zestawu do sekwencjonowania T7 z Pharmacia (Piscataway, NJ).
serologiczna analiza markerów wirusa zapalenia wątroby typu B i C
HBsAg zmierzono za pomocą Ausria II (Abbott Laboratories, North Chicago); przeciwciała anty-HBc, anty-HBc IgM, HBeAg i anty-Hbe i anty-HBs mierzono odpowiednio przez Corab, Corzyme-M, HBe (rekombinowany DNA) i Ausab (Abbott). Test immunoenzymatyczny w celu wykrycia przeciwciała przeciwko wirusowi zapalenia wątroby typu C 10, 11 przeprowadzono zgodnie z instrukcjami producenta (Abbott). Próbki badano w dwóch powtórzeniach, a tylko próbki o jednorodnie dodatnich wynikach rejestrowano jako reaktywne.
Wyniki
Tabela 1. Tabela 1. Niejednorodność sekwencji DNA wśród wirusowych szczepów zapalenia wątroby typu B * DNA HBV pomyślnie powielono z surowicy od czterech z sześciu pacjentów (pacjentów 1, 2, 4 i 5) i podejrzewanego pacjenta źródłowego przez antygen. -HB metoda wychwytu-PCR. 8 Używając standardowej ekstrakcji DNA surowicy, a następnie amplifikacji PCR, byliśmy również w stanie z powodzeniem z powodzeniem DNA HBV od pozostałych dwóch pacjentów (Pacjenci 3 i 6). Ci dwaj pacjenci mieli bardzo wysokie miana przeciwciał anty-HBs, które mogły uniemożliwić przechwycenie krążących wirionów HBV uwięzionych w kompleksach immunologicznych przez anty-HBs związane z podłożem w fazie stałej.
[hasła pokrewne: poradnia endokrynologiczna dla dzieci, choroba raynauda leczenie, neurolog dziecięcy radom ]